Rodadas. Una comunidad de cicloturismo y viajes en bicicleta
Volver arriba

Presentación del bicho negro

&tarr; PUBLICIDAD (lo que paga la factura)

  1. A veces los sueños se cumplen y de forma inesperada, además como soy facil de convencer, me han convencido y me han liado, yo queria una Domane de aluminio y al final he salido con una de carbono, pero no es una Domane cualquiera, no, al final me he venido arriba y me he llevado lo más nuevo, lo último de Trek, la Domane SRL, ultima tecnología americana, negra, preciosa, todo Ultegra mecánico, el eléctrico me parecía ya demasiado dinero, así que me he quedado con este bicho negro del cual no puedo poner ahora la foto, asi que abriré otro hilo para insertar las fotos

    Dios creó la cerveza, el diablo la Coca-Cola.
    Publicado hace 5 años #
  2. Los sueños se cumplen Agustin, enhorabuena me alegro muchisimo, fotos fotos queremos fotos, muchas fotos de esa maravilla!!!!!

    Publicado hace 5 años #
  3. Agustin_58 dice: A veces los sueños se cumplen y de forma inesperada, además como soy facil de convencer, me han convencido y me han liado, yo queria una Domane de aluminio y al final he salido con una de carbono, pero no es una Domane cualquiera, no, al final me he venido arriba y me he llevado lo más nuevo, lo último de Trek, la Domane SRL, ultima tecnología americana, negra, preciosa, todo Ultegra mecánico, el eléctrico me parecía ya demasiado dinero, así que me he quedado con este bicho negro del cual no puedo poner ahora la foto, asi que abriré otro hilo para insertar las fotos 

    A todo esto yo estaba flotando, con unas ganas tremendas de irme de la tienda a dar pedales mientras Alfredo, el de la tienda, seguía moviendo los papeles del pedido.

    Le faltan varias cosas para ser el bisho negro brevetero que yo quiero, los guardabarros delantero y trasero y el transposrtín trasero con su bolsa de click Bontrager para ponerlo y sacarlo enseguida.

    Alfredo, de Cicles AB en Castellón es el que está sonriendo detrás del mosrador, es un liante, yo queria una Domane de aluminio y transmisión 105 y el tío me ha liado hasta que he acabado con ese bisho, todo de carbono, transmisión completa Ultegra mecánica y con no se cuantos elastómeros que según dice él me harán el rodar más cómodo. Las ruedas son de 7000 x 28, menos presión que las 700 x 23 que llevaba en la Mendiz y en algo se tendrá que notar en cuanto a comodidad.

    En cuanto he podido me he montado encima del bicho negro y nos hemos ido, que esta hoy ya duerme conmigo y es literal, en la misma habitación. Me he ido a probarla, a ver si la inversión ha merecido la pena y le he hecho estas otras fotos.

    No se ven los letreros de Trek, las letras están también en negro, si te acercas se ven, pero se han vuelto discretos los de Trek y no destacan mucho.

    Detalle de la piñonera, con su gran corona de 32 dientes, que llega una edad en la que hay que cuidarse y a veces me meto en unos jardines de los que sólo puedo salir empujando.

    La bici parece que está pensada para brevets o cicloturismo, los americanos, muy previsores ellos, la han dotado con anclajes para guardabarros y portabultos trasero, de hecho, a la mia le falta todo eso, que no lo han podido instalar por un problema con los frenos y la anchura del guardabarros, el importador no ha podido dar una solución y lo han consultado a los USA, que se supone sabrán que hacer para instalar el guardabarros y el transportín que ellos mismos han inventado para esta bici.

    Hemos pesado el bisho y con los dos botelleros y el GPS Garmin 810 montado pesaba 7,900 kgrs. casi ná, 3 kilos menos que la Mendiz que se acercaba a los 11 kgrs.

    En orden de marcha es mucho más rápida y estable que la anterior, se nota el alargamiento entre ejes, se ve más pedazo de rueda delantera en posición de marcha, el cambio Ultegra es suave como el solo, con un toquecito cambia y engrana piñones y platos perfecta y suavemente. 

    Es muy cómoda, incluso con ese sillín con punta, he hecho unos 20 kilómetros, para quitarme las ganas y he pasado por todos los baches, tapas de alcantarilla, rugosidades y bordillos que he encontrado. La suspensión se nota, suaviza loas baches de la carretera, que ya no siento hasta el cogote, ahora es como si fueran algodonosos, me he metido por un paseo de la playa de Castellón por el que con la Mendiz no podía pasar, tal era el traqueteo y vibraciones al que me sometía el piso, pues hoy he pasado mucho mejor, no ha desaparecido el traqueteo completamente, pero al menos no es molesto, los elastomeros del tubo del sillín y de la dirección junto con el que lleva dentro el manillar, habrán absorbido toda esa vibración y ahora no resultaba molesta.

     La aceleración y velocidad que tiene es muy buena, hasta que se ha muerto el Garmin por falta de batería, he visto continuamente 30 km/h y hasta 32 km/h en llano, esto ultimo tendré que comprobarlo mañana a ver si es verdad o solo lo he soñado, pero la he notado mucho más rápida y potente, las salidas de las esquinas en que tienes que matar la bici al entrar y luego salir de pie son mucho más sencillas y potentes que con la Mendiz.

    Yo estoy contento con la compra que he hecho, mi hijo no, se ha cabreado conmigo y es que esta semana me he comprado un coche también, de ocasión pero está como nuevo, me lo darán el viernes y el sábado me llevará a la brevet de 200 k, de Massamagrell, que si no, no tenía coche para ir, hubiera tenido que ir en tren o en bici el dia antes y quedarme a dormir allí, ya que la salida del primer grupo es a las 7'30 y he pedido que me incluyan en el para no descolgarme demasiado, que esta gente están muy fuertes.

    Mañana quiero hacer una prueba más seria, 100 k. o más y no me pondré el culotte, hoy he salido con mallas finitas y he notado un poco raro el sillín, veremos mañana como voy, además la quiero probar subiendo, al Desierto de Las Palmas o unas rampas, más bien muros, que tenemos cerca de la costa, como llevo un Garmin que dice el porcentaje de subida, mañana sabré lo que estoy subiendo, espero cargarlo bien y que no se agote la batería como me ha pasado hoy.

    En fín chic@s, ahi tenéis al Bicho Negro, espero que os guste como me ha gustado a mí.



    1. Bici4.jpg (182.8 KB, 0 descargas) 5 años antiguo
    2. Bici3.jpg (213.8 KB, 0 descargas) 5 años antiguo
    3. Bici2.jpg (190.4 KB, 0 descargas) 5 años antiguo
    4. Bici1.jpg (212.5 KB, 0 descargas) 5 años antiguo
    Publicado hace 5 años #
  4. Es la que acaban de presentar, coincidiendo con la Roubaix, no? He leido maravillas de ella, y de sus sistemas de suspensión activa, amen de ser un cohete!!! Cuanta espera tienes?

    Publicado hace 5 años #
  5. Nos hemos solapao... te la has llevado puesta??? Que grande!!!!

    Publicado hace 5 años #
  6. Txerekenke dice: Nos hemos solapao... te la has llevado puesta??? Que grande!!!!

    Ya hacia una semana que la había pedido y por problemas de logística y taller, no tenían tiempo de montarla, me la llevé ayer.

    Hay una cosa que me ha llamado la atención, hace ruido al rodar, supongo que será por los neumaticos de 28, antes iba con 23 y era más silenciosa. pero se nota que llevo otra cosa diferente a lo que tenía, de hecho no cuesta mover el plato grande tanto como con la Mendiz y noto que es más ligera con mejor respuesta a la pedalada y por lo tanto acelera antes.

    Esta tarde le haré más pruebas, a ver si me puedo acercar a los 100 km, y subir algo de montaña, que el sábado tengo brevet de 200 y si se desajusta algo he de tener tiempo a que lo arreglen.

    Los frenos Ultegra, que tienen un diseño nuevo, son para tratarlos con cuidado, tienen mucha potencia y ayer clavé la rueda trasera en un par de ocasiones sin apretar demasiado, hay que hacerse al nuevo equipo y tratarlo con cuidado al principio.

    La postura de conducción es muy cómoda, me hicieron un estudio biomecánico en la misma tienda y la tengo a mis medidas, será por eso que es muy cómoda o que realmente las tecnologías adelantan que es una barbaridad.

    Ahora me he de estudiar el funcionamiento del GPS, no sea que el sábado llegue a Burgos antes que a Massamagrell, le he puesto un Garmin Edge 810 con pack de pulsómetro y como lleva el medidor de velocidad y cadencia integrado en el cuadro no hay que montarle el imán, aunque si no detecta transmisor, con la navegación por GPS también me da los datos de distancia, velocidad y pulsaciones con el pulsómetro. 

    El sillín con esa punta no me resultó del todo incómodo, aunque el Duopower me sigue gustando más, veremos si me adapto a él o le monto un Duopower, he escrito a los de Duopower y me han aconsejado el Nelox para ciclismo de fondo, que es lo que yo hago, en la Mendiz llevaba el Aero, con menos mullido que el Nelox, veremos como se da la cosa y la probaré con culotte, que a cambiar siempre estoy a tiempo.

    Ya contaré más impresiones cuando la ruede un poco más.

    Publicado hace 5 años #
  7. ¡¡¡¡¡¡¡¡guuuuaaaaauuuuuuuuuu !!!!¡¡¡¡¡que pasada de bici, te la mereces, (y una bici tan guapa, tambien te merece a ti)-

    Caballo loco......pica pero pica poco
    Publicado hace 5 años #
  8. Bicicleton!! Yo quiero la misma! Que guapada!  

    Una pregunta, la "suspensión" que tiene en el cuadro, se nota cuando te pones de pie en la bici? Es decir se nota la flexion al pedalear  por llevar esa amortiguacion o solo notas la absorcion de vibraciones y el resto como bici normal?

    Es una bici preciosa. Espero ir leyendo tus comentarios que siempre van bien por tu objetividad y rigor. 
    Felicitaciones y saludos
    Suerte el sabado

    Publicado hace 5 años #
  9. Qué alegría, Agustín, después del disgustazo que te llevaste, y es que, ¿qué sería la vida sin poder cumplir sueños de vez en cuando? Si algún día nos cruzamos con las Domanes y los maillots bicibizivici puestos, no necesitaremos un clavel en la solapa para reconocernos 

    ¡Bici, bizi, vici!
    Publicado hace 5 años #
  10. Preciosa Agustín, ahora a disfrutarla  y a hacerle muchos muchos kms

    Publicado hace 5 años #
  11. a volar!!!!

    es una maquina, con todas sus revisiones pasadas y full equipe!!!

    vas a disfrutar como un niño chico.

    Aquí yace Raffaello Sanzio.
    Cuando nació la naturaleza temió ser vencida por él. Cuando murió temió morir con el.
    Publicado hace 5 años #
  12.     Felicidades Agustín,menuda maquina.Me alegro por ti,en la vida permitirse algún que otro sueño no es ta mal,invertir en la bici,no es sólo invertir en ocio y salud ,también ganas mucho en ilusión y felicidad. 

       Y menudo estreno,200 km el sábado .Ahora bien  ,ten un poco de paciencia,por lo menos en mi caso,hacerse a una nueva bici (su geometría,desarrollos,sensaciones,etc) y terminar de acoplarse a ella , lleva aunque sea poco,algún tiempo.Y nos contaras.

    Publicado hace 5 años #
  13. Poca gente conozco que la merezca más, y vaya si vas a saber disfrutarla desde el minuto uno, sea en la brevet de 200k o no (que a fin de cuentas tu cuerpo ya está hecho a la Mendiz).

    Felicidades !!!

    Gandulus maximus. Vires acquirit eundo. Et Iniuriam.
    Publicado hace 5 años #
  14. Enhorabuena

    Ya imaginaba algo asi cuando dijiste lo de la sorpresa jajajaja
    Ahora a Disfrutarla con muchos kilomentros Agustin
    Ya nos contarás que tal la primera brevet

    Publicado hace 5 años #
  15. Agustin, felicidades por la nueva adquisición!

    Leonor, tu serás SIEMPRE la princesa...
    Publicado hace 5 años #
  16. Agustinnnnn....menudo pepino te has pillado!

    con semejante artefacto ahora sere yo el que me pegue a tu rueda.
    nos vemos el sabado

    Publicado hace 5 años #
  17. Menudo avión ... Enhorabuena !!!

    Publicado hace 5 años #
  18. Agustin .... traidor ...  el carbono es para nenazas !! ...
    Y encima le habrás montado un compact !!!
    ya no se ven hierros por las carreteras .. 
    Saludos , y a disfrutar

    Publicado hace 5 años #
  19. Je Je Je, estoy como un niño con zapatos nuevos, ayer mentí a los clientes con los que tenia concertada una cita por la tarde y me fuí a probarla, a ver si me aclaro con el Garmin y os doy datos, pero la sensación es de volar, es rápida, el plato grande es una gozada y con los 11 piñones atrás siempre tienes desarrollo para circular a cadencias altas, suelo buscar las 85 pdm y ayer las encontraba y mantenia fácilmente, además el Ultegra cambia fino fino y al instante, nada que ver con el Campagnolo Veloce de la Mendiz que se lo pensaba ántes de responder a la palanca.

    Ante todo es una bici cómoda, es la primera impresión, no se si es por el neumático de 28 que absorbe de por sí más vibraciones que el de 23, por los elastomeros que lleva, en la dirección y en el tubo del sillín, o por el propio cuadro de carbono, pero es un pepino cómodo y rápido. Ayer calculo que hice unos 80 km, con muchas paraditas por culpa del móvil que no paraba de llamame, la mayoría clientes pués estaba en horarios de trabajo y yo pedaleando,

    El pedaleo de pie es incluso más efectivo que con la Mendiz, eso sí, le he de poner un par de piñones menos par pedalear cómodo y el elastomero no se lleva nada de fuerza, toda va a los pedales, en cuestas de pasos de autopista que las ves venir, le bajo uno o dos piñones y en cuatro pedaladas se suben, es como si toda la fuerza que hago en los pedales fuera directamente a la rueda. Casi al final del recorrido me fuí a subir un pequeño puerto con una rampa del 9% que dura unos 300 m. le metí el 32 con el plato pequeño y tranquilamente para arriba, sin levantarme del sillín, con la otra me costaba un montón pasar ese tramo. También he notado que en velocidad de crucero es más rápida, cuando salgo suelo encontrar a chavales de 20 años que ántes me adelantaban con bicis de montaña, ayer no me adelantó nadie, es más, dejé a dos que me vieron y vinieron a por mí, le puse el plato grande y los dejé atrás, no tengo idea a que velocidad iba, pues el sol me reflejaba en el Garmin y no veía ni velocidad ni cadencia ni nada, pero los dejé atrás, con un poco de esfuerzo, pero no me adelantaron y eso para mí ya es todo un éxito. 

    No se si es por el mayor rozamiento de los neumáticos de 28 o por el cuadro de carbono, pero hace ruido al rodar, ruido raro, ya me voy costumbrando a él, cuanto mayor es la velocidad más ruido, pasaré por la tienda a ver si es normal y como tengo que ir a que me den el transportín para montarlo para el sábado, aprovecharé para preguntar y cogerme un par de cámaras de repuesto que ayer pinché.

    Con los guardabarros y el transportín con la bolsa integrada de Bontrager, va a quedar una brevetera preciosa, cuando lo tenga todo instalado ya haré una fotos y os la enseñaré.

    De momento, contentísimo con la adquisición y el resumen es que sobre todo es cómoda, entre la absorción del carbono, el tubo de la tija que se mueve y el Isospeed en la dirección absorbe muchos de los baches y suaviza enormemente los traqueteos, ahora ya no esquivo las tapas de alcantarilla, ranuras del asfalto, paso por tramos adoquinados, etc, si paso por encima, no problema, apenas se notan, Al levantarte a pedalear demuestra más eficiencia, el cuadro no se dobla y toda la potencia va a los pedales, lo que te da más rendimiento con el mismo esfuerzo, sale como un cohete cuando le das con ganas, en velocidad de crucero es rápida, con una respuesta excelente a la aceleración en cualquier desarrollo. A ver si me aclaro para mirar en el Garmin la salida de ayer y veré si he mejorado en rendimiento.

    Gracias por las felicitaciones, la tengo en mi habitación, duerme conmigo, no en la cama porque es muy grande, pero a mi lado si que está, jajajajaja.

    A pedalear que es sano y divertido.



    Publicado hace 5 años #
  20. Enhorabuena amigo Agustín, sin duda te mereces tener algo así. Disfrútala.

    Publicado hace 5 años #
  21. Gracias Vicent, yo creo que con unas cubiertas de ciclocros esto dará para hacer la Via Verde de Ojos Negros, tengo una idea en la cabeza para pasar un fin de semana en la Via Verde, ya te la contaré a ver si te animas.

    Un abrazo

    Publicado hace 5 años #
  22. Respecto a ese ruido raro que oyes, han de ser las cubiertas de 28, te aseguro que mi bici es lo más silencioso que he tenido nunca. Por cierto, veo que pinchaste en tu primera salida larga. Si eres de los que, como yo, no soporta los pinchazos, te recomiendo las Schwalbe Durano plus (yo las uso de 25 pulgadas). Hombre, llevarlas supone sumarle 300 gramos al peso de la bici respecto a las Durano a secas, y supongo que eso no te hará gracia, pero tener la seguridad de que no pincharás no tiene precio, al menos para mí. Esta bici es adictiva, Agustín, si ya eras un loco de la bici a partir de ahora no te van a ver el pelo, ni la familia ni los clientes, jajajajaja... 

    Publicado hace 5 años #
  23. Si es adictiva si, ya estoy pensando en salir esta tarde otra vez, pero es que ayer retrasé a un cliente para hoy, así que no tengo más remedio que acudir. veremos si más tardecito me puedo hacer un hueco y darle unas pedaladas. Voy a pasar por la tienda a preguntar lo del ruido, yo creo que como dice Sargantana es por los neumaticos de 28.

    Los número de ayer buenos, recorrí 97 km, estuve 5 horas y 26' de viaje, paré cinco o seis veces a hablar por teléfono, merienda incluida y reparé un pinchazo en ese tiempo, aún así me sale una media de 17'36 km/h, el último, pero llego en tiempo de brevet.

    Voy a pasar por la tienda para que me den el portabultos y montarlo aunque sea sin guardabarros, que para la brevet del sábado necesitaré llevar cosas además de una chaqueta cortavientos para la salida, que es a las 7'30 de la mañana, no sea que me resfrie y la liemos, que tengo ganas de disfrutar más de la bici.


    Publicado hace 5 años #
  24. Los clientes deben comprender que tienen que esperar.  Se trata de algo extraordinario.  Disfrútala.

    Publicado hace 5 años #
  25. Ayer me pasé por la tienda a comprar otra cámara de repuesto, efectivamente fué un pinchazo, supongo que subiendo el puertecito de las cuestas de Oropesa por la carretera vieja, me costaba mucho subir al final, donde suaviza un poco y se queda con una pendiente del 6% y era por culpa del pinchazo de la rueda de delante, menos mal que al dar la vuelta me dí cuenta, al bajar ese puerto te pones casi a 60 km/h sin dar pedales, imaginaros lo que podía haber pasado si la rueda delantera se queda sin aire a esa velocidad, tortazo seguro,

    Lo del ruido al rodar me confirmaron en la tienda que es por el neumatico de 28, que si me molesta mucho le puedo poner el de 25 que es más silencioso, ya veremos, de momento seguiré con el de 28 para no tocarla demasiado de cara a la brevet del sábado. Ayer la dejé en la tienda para que me montaran el transportín trasero, es el original de la bici, Bontrager y no pesa nada, además me pondrán la bolsa que le corresponde, Bontrager también, para que pueda llevar trastos el sábado en la brevet, un par de cámaras, algo de comida, los polvos de hidratación, Vitalink de Infisport que me van muy bien, la chaqueta cuando me la quite, la bomba para hinchar en caso de pinchazo, un power bank para el Garmin por si se le agota la pila, guantes cortos, que por la mañana saldré con los de invierno, las barritas de comida y alguna cosa más que ahora no se me ocurre, con el transportín y la bolsa ya será mas brevetera que ahora. Esta tarde pondré fotos con el transportín instalado. 

    Los guardabarros aun no saben como montarlos, dicen en la tienda que muy poca gente se los instala y con el diseño nuevo de los frenos, que no son Ultegra, son Bontrager, quiero llevarlos, aunque en Castellón llueva poco, quiero que sea una bici brevetera y en las brevets se llevan guardabarros, así cuando salga a entrenar me verán y no pedirán guerra, que hay mucha gente por ahí que sólo piensa en adelantar al de delante y si lleva un aparato como el mío más aún.

    Pues eso, de momento a esperar que esta tarde me la dan a ultima hora.

    Por cierto, esta mañana me dan otro juguetito, este es de ocasión, pero como si fuera nuevo, el coche para poder ir hasta la salida de Massamagrell, que el Mondeo está ya para el desguace y como no pude pasar la ITV y ya ha vencido, si lo cojo me juego una multa de 150 lereles como mínimo, así que buscando por la red y las casas de compraventa de coches me he pillado un Volvo S40 con pocos kilómetros y a muy ben precio, está como nuevo, el problema que tiene es que la bici no me cabe en el maletero y la tendré que llevar en el asiento de atrás sin las ruedas hasta que me pongan una bola de remolque y la pueda llevar detrás del coche. Por cierto y no se lo digais a nadie, me he gastado más pasta en la bici que en el coche, jijijijiji, pero no me arrepiento, lo primero es lo primero. 

    Hasta la tarde que pondré las fotos con el transportin y la bolsa para llevar trastos.

    Publicado hace 5 años #
  26. Hoy he visto en directo al bicho negro, y tengo que decir que es mucho más bonita que en las fotos. 

    El transportin y la bolsa le quedan muy bien.

    Enhorabuena y disfruta de ella.

    "Más vale sufrir una injusticia que cometerla".
    Publicado hace 5 años #
  27. Felicidades por la adquisición Agustín, guapísima, que la disfrutes.


    Tengo mono de viajar
    Publicado hace 5 años #
  28. Señores, el Bicho Negro cumplió, el sábado terminé en tiempo, con transportín y un montón de trastos dentro de la bolsa que no me sirvieron para nada, la brevet de 200 km. de Massamagrell, el último y sólo me sobraron 45' de tiempo, pero la terminé, que es de lo que se trataba, la bici la noté un montón, con la vieja no hubiera podido terminarla, estoy contentísimo con la bici y con su rendimiento.

    Un abrazo para todos

    Publicado hace 5 años #
  29. Más pruebas con la bici, es un bisho de mucho cuidado que vale para todo, ayer me metí por unos caminos que no me aconsejaban, pregunté en una gasolineara y el chaval me dijo que con esa bici no me consejaba meterme, hay piedra suelta y con esas cubiertas las rajaba seguro, le dije que era una Domane y que la habían parido para tirar por donde fuera con comodidad, que llevaba suspensión y el tío no se lo creia, que eso no eran suspensiones como las de su mtb, no, pero ayudan y mucho cuando ruedas por terrenos no asfaltados. 

    Me subí hasta Algar desde Castellón por carretera de buen asfalto, cogí la vía de servicio y allí el asfalto ya no era tan bueno, pero observé una cosa que ahora no hafo y con el cuadro de acero tenia que hacer, es que cuando hay baches, o pasas los pasos de peatones elevados, no dejo de pedalear, con la anterior a llegar al paso de peatones elevado tenía que dejar de pedalear para levantar el culete del sillín, para que no me diera golpe en los cataplines, pues la Domane absorve ese golpe y se puede seguir pedaleando tan ricamente. Con las grietas del asfalto pasa lo mismo, al cruzarlas antes notaba un toc toc en las dos ruedas que sentía hasta en el cogote, como si todo el golpe se transmitiera por el cuadro hasta la cabeza, pues ahora lo que noto es un plof plof que no molesta y te permite seguir pedaleando En el manillar me llegan esas vibraciones amortiguadas pero siguen llegando aunque no tan molestas.

    En principio es cómoda y tiene un rodar muy fácil, puedo estar más tiempo que antes pedaleando de pie y algo muy importante, si no voy cómodo con el pedaleo de pie, cambio de piñón sin dejar de pedalear, tanto poner un piñon más pequeño como subir a uno más grande, eso supongo que seá por el Ultegra, pro ni se nota que pegue tirón ni ruidos excesivos de la cadena.

    En llano es un cohete, ántes solía ir máscogido de los escaladores que de la parte de abajo del manillar, ahora es al revés, me cojo de la parte de abajo y con la misma cadencia gano 1 km/h en velocidad y además voy cómodo, sin dolores de hombros ni de brazos y como soy más aerodinámico las pedaladas rinden más.

    Ayer fueron 127 km en solitario, el viento iba para todos los lados, igual lo tenía de frente, me cogía de abajo y se notaba menos la molestia o lo llevaba de popa y me ayudaba a pedalear, en esos momentos aparecian en el cuenta kilómetros cifras de más de 30 km/h, cuando llegué a Castellón me metí por las rondas y nada de carril bici, iba rodando por la carretera sin viento a 32 km/h despues de meterme 124 en el cuerpo con casi 6 horas pedaleando y me supo a poco, me bajé de la bici en casa con ganas de más, es adictiva, pienso que por la comodidad y la facilidad de pedaleo, que da igual el plato que le pongas, siempre hay un desarrollo bueno para pedalear. Salí con el portabultos trasero y la bolsa de Bontrager, no me molestó en absoluto y ya os he puesto a las velocidades que rodaba. 

    En la brevet ya lo hice y hoy lo he vuelto a hacer, cuando para a comer un bocadillo, lo pido partido en dos trozos, uno me lo como insitu y el otro medio un par de horas después, no me doy una panzada y a las dos horas que necesito más alimento tampoco me doy otra panzada, creo que esto es importante para el ciclismo de larga distancia, no comer en exceso y hacerlo poco pero más seguido.

    Ayer la metí por unos caminos que me daba miedo lo que podía pasar, me encomendé a que San Cancellara hubiera hecho un buen trabajo y los ingenieros de Trek lo hubieran interpretado bien, pero había que probar a meterme por pistas o sendas en mal estado para una bici de carretera y hasta en las subidas que tuve que pedalear de pie, su comportamiento fué exceente. Me daba miedo meterla por la piesta por si se rompía, pero la rigidez del cuadro y las cubiertas de 28 hicieron bien su trabajo. aguanta como una campeona lo que le eches y puedes cambiar sin dejar de hacer fuerza en los pedales en cualquier situación, con lo que no te quedas clavado en ningún momento, el cambio tambien es rápido, por lo que si te echas encima de una cuesta pronunciada se lo puedes meter todo en un santeiamén y salir del apuro pedaleando, con la otra había veces que tenía que echar pie a tierra para no caerme.

    A ver si pudo subir fotos y os enseño por donde nos metimos, nadie me aconsejó que lo hiciera, pero en estos caminos tampoco está su límite.

    Aqui se puede apreciar más o menos por donde nos metimos, la sendita gris es la via verde y por ahi pedaleamos


    Publicado hace 5 años #
  30. Por fín las fotos, no podía acceder a las del móvil por la seguridad, había que instalar un programa en el ordenador y autorizar en el móvil que el ordenata pudiera entrar a ver las fotos y aquí están

    Esta es la primera senda que ví, ya fuí una vez con la Mendiz y las cubiertas de 23, me acojoné y no me atreví a entrar, con la Domane y sus neumáticos de 28 me metí y subimos la cuesta tan ricamente:

    Publicado hace 5 años #


Aún sin etiquetas.

  • (No hemos encontrado ningún hilo silimar)